Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6088 precursor URS000075C97D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6088: Hsa-mir-6088 is a microRNA that has been identified in various studies and is involved in different signaling pathways. It has been found to interact with CBFB gene in the Smad2/3 signaling pathway and with hsa-mir-6088 and CHRD gene in the TGF-β signaling pathway [PMC7365136]. Hsa-mir-6088 has also been identified as a highly expressed miRNA in ceRNA networks [PMC7448472]. In addition, hsa-mir-6088 has been found to be reduced in the RIF group compared to the control group [PMC5339930]. It is also considered as one of the top features in two different methods, highlighting its visibility and importance [PMC9068882]. Hsa-mir-6088 has also been identified as a potential Exo-miRNA and is involved in ADM [PMC8104147][PMC9978013]. Furthermore, hsa-mir-6088 is considered a key regulator of the pathological process of ACS [PMC7670299]. Finally, it has been found to have strong statistical differences between NPC patients with different radiosensitivity [PMC7083955]. Overall, hsa-mir-6088 is a microRNA that plays various roles in different pathways and diseases. It can interact with different genes and is involved in processes such as signaling pathways, ceRNA networks, radiation-induced fibrosis (RIF), acute myocardial infarction (AMI), acute coronary syndrome (ACS), nasopharyngeal carcinoma (NPC), and radiosensitivity.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGAUGAAGCGGGGGGGCGGGGUCUUGCUCUAUUGCCUACGCUGAUCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications