v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ficedula albicollis (Collared flycatcher) microRNA 17 secondary structure diagram

Ficedula albicollis (Collared flycatcher) microRNA 17 URS000075C925_59894

  • 85 nucleotides
  • 1 database (Ensembl)
  • Found in 2 other species
  • pre_miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCAGAGUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUAUAGAACCUACUGCAGUGAAGGCACUUGUAGCAUUAUGUUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gallus gallus microRNA gga-mir-17 precursor
 2D structure