Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-4435 precursor (hsa-mir-4435-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-4435 precursor (hsa-mir-4435-2) URS000075C91E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4435-2: MIR4435-2 is a long noncoding RNA (lncRNA) that is located on human chromosome 2q13 and is known as MIR4435-2 host gene (MIR4435-2HG) [PMC8054316]. It has been identified as an oncogenic lncRNA that is implicated in various tumors, including ovarian cancer, colorectal cancer, gastric cancer, hepatocellular carcinoma, and head and neck squamous cell carcinoma [PMC8054316]. MIR4435-2HG has been found to recruit miRNAs to participate in tumor progression [PMC9208505]. It has also been reported to promote lung cancer progression by activating β-catenin signaling [PMC6861872]. MIR4435-2, which is hosted by MIR4435-2HG, has been considered a biomarker in various cancers such as oral squamous cell carcinoma [PMC7655182]. The function of MIR4435-2 is still unknown [PMC6732945]. The lncRNA AWPPH on chromosome 2 serves as the host gene for MIR4435-2 [PMC6732945]. AWPPH and TGF-β1 may interact with each other through the mediation of MIR4435-2 [PMC6732945]. The lncRNA CYTOR on chromosome 2p11.1 overlaps with miR4435-1 and MIR44352. These three genes have been identified through association testing for their significance in certain diseases or conditions such as hepatocellular carcinoma and poor prognosis of tumors [PMC7443120]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAAAUGGCCAGAGCUCACACAGAGGGAUGAGUGCACUUCACCUGCAGUGUGACUCAGCAGGCCAACAGAUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications