Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-103b URS000075C8F4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-103b: Hsa-mir-103b is a microRNA that is sense-stranded and is often confused with hsa-miR-103a-3p due to their reverse complementarity and slight nucleotide sequence differences [PMC4029070]. In a study on mitochondrial miRNAs, hsa-mir-103b was found to be one of the most abundant miRNAs associated with mitochondria in HEK293 and HeLa cells [PMC3439422]. However, it was observed that hsa-mir-103b did not associate with target genes/mRNAs in another study [PMC5629558]. In the context of breast milk thawing, the expression levels of hsa-miR-103a-3p and hsa-mir-103b decreased when a bottle warmer was used, except for one participant [PMC9963775]. Hsa-mir-103b has also been found to be overexpressed in CF plasma compared to healthy control samples [PMC6820733]. In lung cancer-related studies, hsa-mir-103b has been identified as one of the predictive target miRNAs associated with lung cancer development or drug resistance signals [PMC9772949]. Additionally, it has been found that hsa-mir-103b regulates the expression of target genes such as BMP6, GPX3, and VPS8 [PMC9777571]. Hsa-mir-103b is one of several microRNAs that can be transcribed from multiple genomic locations, resulting in different isoforms or isomiRs [PMC7566571].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAUAGCCCUGUACAAUGCUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications