v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 412 (LINC00412) URS000075C894_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00412: LINC00412 is a long non-coding RNA (lncRNA) that has been identified as a glycolysis-related lncRNA correlated with prognosis in various cancers, including gastric cancer (GC), colorectal cancer (CRC), and pituitary tumors [PMC9548545] [PMC9676246] [PMC9709405]. In GC patients, LINC00412 was found to be a protective factor [PMC9676246]. In CRC, LINC00412 was one of the lncRNAs used to construct a prognostic model for survival time prediction, immune infiltration, and chemotherapy drug sensitivity [PMC9709405]. Additionally, LINC00412 was found to be downregulated in tumor cells compared to normal cells in CRC [PMC9709405]. Furthermore, LINC00412 was included as one of the 10 biomarkers for the construction of a prognostic model for cardia cancer [PMC9709405]. In pituitary tumors, LINC00412 was found to be upregulated in all types of tumors [PMC9709405].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAAAAAAGAUUGUAAAAAGGUUAUUCUCCUUUUUAUAACAUCUGUGUGAGGCUGCAUUUUCUUCAUAUUCCUGUACUUCAGCCAAACGGCAUAUGGCAAUAGAUUUGAUGCAAAAGCAGACACGAAUAUCUCGUUAUCUUUGAUUAAGCUAGACAUUAAGUAAAGACAUUGGAAAACACUAAACAUUAAAAACAACGCCACACUUCUUAACGUAUUUUUUCUGGGAAGUAUUGUUAUAAAAUGUUAUUUAUGUUAACAUGUAGGGUUUUAAAAAUUAUUUUUAUGUAAGUUAAUGAGUAUACAAAUUCUUCAUUUUAACUUCUGAUAUAUGGUAAAUAUUGAUAGAUAAAAAUCACACAAGCAAAAGUUGUCACUGAUCCUCAGUAAUUUUUUGACAGGUAAAGAUUUCCCAAGACCAAAAAGCUUAGGAGCACUGCCCCAUUCCACUGUUCUGCUGCUGGUUUUGCUUUGACUCUCCCAGAGGAAAACCGGGGUUGUCACUGGAAGUUCCUGAAGUAAUCUCCUUUUUUAGCAAACUUUUCAUUAUUACACUAUUUGGGUCAUGGUACAACUUUGCUGAAUUGCCUUGAACUGAAGUAUUGGAUUUUUACUUUAAUUUAUCCUGUGAUUAUGCUGAUUUUGCUUCACUGAUAUUCUGUCAUGUCCUUAGAUUUCUAAUGAAACUGCUCAGAAAUCAACCAGGUAAAAUUUUAUGGGAAAGUUAGGUGGGGAACUAGCACUUGGUUAUGUUUGUAUAAAAAGAAACCCACAAAAUUUUUUCUCAAAACAGUGUUUCUGGUUGUCAAAUGAAAUAGGGGAGCAAUUAGACUUCUGUCUGGUGAGUAGAUUAAAAUAUUUCUGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications