Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-7974 precursor URS000075C799_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-7974: Hsa-mir-7974 is a microRNA that has been identified in various studies [PMC4283225]. It has been found to have potential utility as an antiviral therapeutic against MERS-CoV infection [PMC4283225]. Although its function is not yet known in humans and other animals, it has been identified as a target microRNA of certain circRNAs [PMC9473550]. Hsa-mir-7974 has also been found to be dysregulated and associated with the BOC gene in certain studies [PMC8605868]. In addition, it has been shown to be downregulated after exposure to MPP+, suggesting its potential role in the impairment of cell viability [PMC6626867]. Hsa-mir-7974 has also been found to be involved in the regulation of hsa_circ_0061276 and its binding with hsa-miR-6504-5p and hsa-miR-7705 [PMC9816570]. Furthermore, it is regulated by circRNAs and plays a role in the regulation of target genes of miRNAs [PMC5502157]. Hsa-mir-7974 is also predicted to target OAS1, which possesses antiviral activity against flaviviruses [PMC9167876]. Overall, hsa-mir-7974 is a microRNA that shows potential involvement in various biological processes and may have therapeutic implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCGGCCCCCACAGCGAAACGGCCGCCUAAACCACCCAGGCCUUAUGGCUUCAUAGGCUGUGAUGCUCUCCUGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 7974 (ENSGGOG00000040858.1)
Publications