Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Apis mellifera (honey bee) microRNA ame-mir-31a precursor secondary structure diagram

Apis mellifera (honey bee) microRNA ame-mir-31a precursor URS000075C779_7460

Automated summary: This pre miRNA sequence is 100 nucleotides long and is found in Apis mellifera. Annotated by 3 databases (RefSeq, ENA, miRBase). Described in 6 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-31, RF00661). Apis mellifera (honey bee) microRNA ame-mir-31a precursor sequence is a product of mir-31a precursor, 31, mir-31a, ame-mir-31a precursor, Mir31a, mir-31a precurso, 31a genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUCACGAUUCUAACUGGGCGCCUCGAAGGCAAGAUGUCGGCAUAGCUGAUGCGAUUUUAAAAUUCGGCUGUGUCACAUCCAGCCAACCGAACGCUCAGAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure New