Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1236 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1236 precursor URS000075C764_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1236: Hsa-mir-1236 is an miRNA located in the upstream region of a gene associated with rheumatoid arthritis [PMC3245026]. It is a non-synonymous SNP and is located in a conserved region undergoing positive selection [PMC3245026]. Hsa-mir-1236 has been found to be associated with the differential co-expression between two genes, DEFB4 and OAS1 [PMC3245026]. It has extensive variants and diseases association, including associations with OMIM: 600478, DGV: 3602, 36507, and GAD: 557471, 557472, 557473 [PMC3245026]. Hsa-mir-1236 has also been found to be down-regulated in certain conditions such as human HBV-producing cell lines [PMC5062086]. Hsa-mir-1236 has been shown to target the 17-24 bases of VprBP 3'-UTR [PMC4059663] and VprBP itself is targeted by hsa-mir-1236 [PMC5511817]. The presence of a variant C allele of TLR4 rs11536889 can result in loss of motif binding for hsa-mir-1236 and hsa-miR-642a [PMC5356775]. The start binding position for hsa-mir-1236 has been predicted at position 137 among more than one thousand sequences of NS1 genes in type 1 viruses [PMC3521223].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGUGACAGGGGAAAUGGGGAUGGACUGGAAGUGGGCAGCAUGGAGCUGACCUUCAUCAUGGCUUGGCCAACAUAAUGCCUCUUCCCCUUGUCUCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications