Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4324 precursor URS000075C737_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4324: MIR4324 is a microRNA that has not been previously described in the literature in relation to thyroid carcinoma patients [PMC9221779]. However, a study showed that the expression analysis of four miRNAs, including MIR4324, could improve the accuracy of fine-needle thyroid node biopsy and differentiate between malignant and benign thyroid nodules [PMC9221779]. Higher expression of MIR4324 is associated with papillary carcinoma extending beyond the thyroid gland, while higher expression of miR221 is associated with multifocality, which could help assess the risk and prognosis of thyroid carcinoma [PMC9221779]. The study found that a one-fold increase in MIR4324 value increases the odds of having cancerous disease with metastasis by 8.3 times compared to benign disease [PMC9221779]. The expression levels of four miRNAs, including MIR4324, differed significantly between malignant and benign cases [PMC9221779]. ROC curve analysis showed that MIR4324 was able to identify patients with papillary thyroid carcinoma (PTC) very well [PMC9221779]. The study also found significantly higher expression of MIR4324 in patients with PTC without lymph node metastasis compared to those with lymph node metastasis [PMC9221779]. However, RT-PCR analysis did not confirm the difference in expression between groups obtained by next-generation sequencing for miR125A, miR200B, and MIR4324 [PMC9221779]. Overall, higher expression levels of miR125A and MIR4324 were observed in patients with extrathyroidal tumor extension compared to those without extension [PMC9221779].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGCCCCUUUGUUAAGGGUCUCAGCUCCAGGGAACUUUAAAACCCUGAGACCCUAACCUUAAAGGUGCUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications