v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 251 (LINC00251) URS000075C711_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00251: LINC00251 is a long intergenic non-protein coding RNA (lncRNA) that is involved in various biological processes. In a study, multiple adverse events were detected that involved splicing from exon 43 of the Duchenne muscular dystrophy (DMD) gene to various pseudoexons and LINC00251 exons within a chromosome 8 insertion [PMC8105888]. The study also identified the insertion of approximately 118,000 nucleotides of chromosome 8 sequences within the intron 43 of DMD, which encompassed the LINC00251 gene locus [PMC8105888]. The profound cardiac involvement in a specific family raised suspicion of potential differences in DMD pre-mRNA mis-splicing between cardiac and skeletal muscle activated by the insertion of chromosome 8 sequences containing LINC00251 [PMC8105888]. Another study replicated and validated specific genetic variants, including rs141059755 in LINC00251, which were associated with osteonecrosis [PMC8186476]. Additionally, this study identified several other polymorphisms associated with osteonecrosis in genes such as BMP7, PROX1-AS1, and DOK5 [PMC8186476]. BMP7 has been shown to decrease osteoclast formation and induce apoptosis in vascular smooth muscle cells [PMC8186476]. Another genome-wide association study identified polymorphisms in F2RL1 that were associated with osteonecrosis and suggested a potential mechanism involving clot formation and angiogenesis [PMC7429230]. Furthermore, previous reports have also identified significant loci around GRIN3A, BMP7, LINC00251, and PROX1-AS1 for steroid-associated osteonecrosis of the femoral head (ONFH) [PMC5678103].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAUAUGGGAGGCUCUGCAACAGCAUAUUCUACAAAGAAAAAGAUAAAUGAACAGAAUUCACUCUAAGAUUCACCAUGGAUGUUUACUAGUCAACUUGAUGUCCCAAACCAUCUGCCUAUCUAACACAGCUGAUCUUAAGUUCAUGCUUCACAGCUAUUGGAUGCCCCUUAACCAAGGACUUAGGGCUCAAAUAUUUGAAGAACACUGGAGUCAGGAGACCAGGAUUUCAGAUCUGACUGACACUAACUAGGCUCACCUGGGAGAAACCAGAUGCUCUGUAGGAAAUGCAACGGUCCUGCAAACACCAUGCUAUGGGAAGCCCAAGCCAUGUGCAGAGGCCCUGGAGGAAGAGAUUCAUUGUGUCGAGCAAGAGACCACAUGCAUGAGGAAGCCAUCUUAGAAAUGGAUCCUUCAUCCCACCCAUUUCAGUGUUCCAUGGAAAGCCCAAGGCUCUCAGGAACUGAAGCCCAAAGUGCUUAGUCAUCCAAGAUAUAUAUUACCUUACAGAGGAAGAAACUGGAACAUUUGUUCACACUGCAGAAGAGCCCCUUUCUCUGCUGCCGUUGCUGCCAUCAACAGUAAACACUAGAAGUUUAGGAGCUGAAACCCCAUUGAUUGGCAGACUGCUCUGUCAAGACUGUGGAAUCAAUGGUAGUUUCUCAACAUGUGCUUUGGAGAAGAAGGGAAGACAACUUAUCUGAGGUUCUCUAUAUUCCAGGAGGCCUGAACCUCUGGGAUUGGAUCCCCAGGUGAGCAGCUGACUCAGUUCUCACACCUGCUGCCCUGCCCUCAUUCUGGAGUGACUGUCAGAAGGGGAUUGAGCCUCAGCCACCUGGCCUAGGGCUAGUCCUCCUCUCCAACAACCCAGAUCCUGGAGUUGUGUGCCUAGUUUUGGACUCUCCUUUCCAUCAAAUGACUUUCCCUCUAGAAAGUCCUUUCGUCUCUCCUGCAGGCAGCAUCUGUUGGAUUCACCCUAGUCCAGGAUUAAUCUAUGGCCAGAGGGCCACAUCCGGACCACUACCUGUUUUGGUAAAUAAAAUUUUAUCAGAACGUAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications