Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-3075 URS000075C70A_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-3075: Rno-mir-3075 is a miRNA that is part of a network involving other miRNAs such as rno-let-7c-5p, rno-miR-3542, and rno-miR-504 [PMC8701796]. This network suggests that certain long non-coding RNAs (lncRNAs) including NONRATT002662, NONRATT005090, NONRATT005619, NONRATT019513, NONRATT027738, NONRATT027888, and NONRATT030038 may competitively bind to miRNAs such as rno-miR-449a-5p, rno-miR-5132-3p, rno-miR-344g, rno-mir-3075, rno-miR-378a-5p and rno-miR8743p [PMC7503504]. These interactions can potentially affect the expression and function of hub mRNAs including Pomc (pro-opiomelanocortin), Htr2a (serotonin receptor 2A), and Agtr1a (angiotensin II receptor type 1A) [PMC7503504]. Specifically, it was found that rno-mir449a5p can interact with both Htr2a and Pomc while other miRNAs such as rnomir51323p,rnomir344g,rnomir3075,rnomir378a5p,andrnomir8743pcan interact with both Htr2a and Agtr1a [PMC7503504]. These interactions between lncRNAs and miRNAs influence the expression and function of hub mRNAs [PMC7503504]. Additionally,rnomir3075 was found to be significantly downregulated after GnRH treatment according to sequencing results [PMC10137480].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCUGGGAGCAGCCAAGGACAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications