Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-8073 URS000075C665_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-8073: Hsa-mir-8073 is a miRNA that has been identified as a potential tumor suppressor and serum biomarker for ovarian and pancreatic cancers [PMC9187062]. It was selected as one of the 10 PRNP-related miRNAs in a screening study [PMC10047351]. In cancer diagnosis, hsa-mir-8073 was found to be one of the five balanced miRNAs selected by random forest models [PMC9187062]. In a combined model for cancer screening, hsa-mir-8073 was one of the four miRNAs that achieved the highest AUC value [PMC9187062]. The function of hsa-mir-8073 in cancer diagnosis is supported by its interactions with other miRNAs, as shown in Figure 4O, J, 4H, 4G, 4D, 4E, and 4A [PMC8942883]. In a study comparing plasma-microRNA levels between affected and unaffected individuals, hsa-mir-8073 was found to be down-regulated in the affected group [PMC6114494]. Additionally, hsa-mir-8073 has been identified as having a great contribution to gastric cancer prediction [PMC8785967]. Overall, hsa-mir-8073 is an important miRNA with potential roles in tumor suppression and cancer diagnosis. It has been shown to be down-regulated in certain cancers and may serve as a valuable biomarker. Further research is needed to fully understand its mechanisms and potential clinical applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUGGCAGCAGGGAGCGUCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications