Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-571 URS000075C61C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-571: Hsa-mir-571 is a microRNA (miRNA) that is involved in various biological processes and has been implicated in different diseases. It exhibits complex interactions with other miRNAs in circRNA-miRNA-mRNA/gene networks [PMC5372613]. However, there is limited experimental evidence supporting its role [PMC6781589]. Hsa-mir-571 has been identified as a potential candidate in different studies, including its association with other miRNAs [PMC5610031], its downstream targets [PMC6781753], and its involvement in regulating the expression of certain genes [PMC9902624]. It has also been shown to be important for colorectal cancer carcinoma metastasis [PMC8794677]. Hsa-mir-571 has been identified as a pivotal miRNA regulating SP3 and the level of inflammation and platelet activation in intracerebral hemorrhage (ICH) [PMC9201407]. Additionally, it has been implicated in lung cancer susceptibility by regulating the expression of SMAD-5 through binding to other miRNAs [PMC7401007]. In pancreatic ductal adenocarcinoma (PDAC), hsa-mir-571 is among the differentially expressed miRNAs between patients and healthy controls [PMC5649611]. Furthermore, hsa-mir-571 is linked to common targets with other miRNAs, such as hsa-mir-378c and hsa-mir-499b-3p [PMC7365454]. Overall, hsa-mir-571 plays a role in various biological processes and diseases through its interactions with other molecules.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGUUGGCCAUCUGAGUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications