Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rattus norvegicus (Norway rat) microRNA rno-mir-383 precursor secondary structure diagram

Rattus norvegicus (Norway rat) microRNA rno-mir-383 precursor URS000075C5C2_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-383: Rno-mir-383 is a miRNA that has been found to be significantly up-regulated in the Hip in all three rats [PMC3615960]. However, there is no evidence demonstrating how rno-mir-383 is involved in complicated regulatory networks, especially in MrD [PMC3615960]. In a study comparing significantly deregulated miRNAs, rno-mir-383 was one of the 10 miRNAs that showed similar expression changes in both the SL- and PH-group at the same postoperative time point [PMC4198680]. However, expression levels for rno-mir-383 were too low for qRT-PCR analysis in rat liver tissue [PMC4198680]. In another study, transfection with an rno-mir-383 mimic effectively upregulated miR-383 expression in colorectal cancer cell lines HT-29 and LoVo [PMC5772728]. This transfection significantly reduced the migratory and invasive capacity of colon cancer cells compared to the control group [PMC5772728]. These findings suggest that rno-mir-383 may play a role in inhibiting the development of colon cancer [PMC5772728]. Overall, rno-mir-383 has been found to be differentially expressed and may have potential implications for both neurological disorders and colorectal cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUCAGAUCAGAAGGUGACUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCCUGGUCAGAAAGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications