v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-9 precursor (hsa-mir-9-1) URS000075C54E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR9-1: MIR9-1 is a microRNA that has been studied in the context of lung cancer, and researchers have demonstrated a proapoptotic effect of MIR9-1 in patients with lung cancer [PMC9220270]. Additionally, the suppression of cell proliferation has been attributed to the action of ubiquitin-like with PHD and ring finger domains 1 (UHRF1) [PMC9220270]. The hypermethylation of MIR130B and MIR9-1 genes has been found to be associated with the highest relative risk of death in lung cancer patients [PMC8835734]. These findings suggest that MIR9-1 may play a significant role in the pathogenesis and progression of lung cancer. Further research is needed to fully understand the mechanisms by which MIR9-1 exerts its proapoptotic effect and regulates cell proliferation, as well as its potential as a prognostic marker or therapeutic target in lung cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Ailuropoda melanoleuca microRNA 9-1 (ENSAMEG00000023334.2)
  2. Capra hircus microRNA 9-1 (ENSCHIG00000008985.1)
  3. Cercocebus atys microRNA 9-1 (ENSCATG00000017669.1)
  4. Chinchilla lanigera (Long-tailed chinchilla) microRNA 9-1 (ENSCLAG00000021123.1)
  5. Colobus angolensis palliatus miRNA (ENSCANG00000009966.1)
  6. Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021204.1, ENSCGRG00001001345.1)
  7. Dipodomys ordii (Ord's kangaroo rat) microRNA 9-1 (ENSDORG00000025794.1)
  8. Echinops telfairi (small Madagascar hedgehog) miRNA (ENSETEG00000021470.1)
  9. Erinaceus europaeus (western European hedgehog) microRNA 9-1 (ENSEEUG00000016104.1)
  10. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000002116.1)
  11. Gorilla gorilla gorilla microRNA 9-1 (ENSGGOG00000031473.2)
  12. Heterocephalus glaber (naked mole-rat) miRNA (ENSHGLG00100024103.2)
  13. Ictidomys tridecemlineatus microRNA 9-1 (ENSSTOG00000016761.3)
  14. Jaculus jaculus microRNA 9-1 (ENSJJAG00000002627.1)
  15. Loxodonta africana (African savanna elephant) microRNA 9-1 (ENSLAFG00000030991.1)
  16. Macaca mulatta microRNA mml-mir-9 precursor (mml-mir-9-1)
  17. Mandrillus leucophaeus (Drill) microRNA 9-1 (ENSMLEG00000012622.1)
  18. Mesocricetus auratus (Golden Hamster) microRNA 9-1 (ENSMAUG00000006205.1)
  19. Microcebus murinus (gray mouse lemur) microRNA 9-1 (ENSMICG00000036169.2)
  20. Microtus ochrogaster (vole) microRNA 9-1 (ENSMOCG00000006181.1)
  21. Mus caroli microRNA 9-1 (MGP_CAROLIEiJ_G0007813.1)
  22. Mus musculus microRNA mmu-mir-9 precursor (mmu-mir-9-1)
  23. Mus pahari microRNA 9-1 (MGP_PahariEiJ_G0007418.1)
  24. Mus spretus (algerian mouse) microRNA 9-1 (MGP_SPRETEiJ_G0008206.1)
  25. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 9-1 (ENSNLEG00000022703.2)
  26. Octodon degus microRNA 9-1 (ENSODEG00000022718.1)
  27. Pan paniscus (bonobo) microRNA 9-1 (ENSPPAG00000014132.1)
  28. Pan troglodytes ptr-mir-9-1 (ENSPTRG00000027638.3)
  29. Pongo abelii miRNA
  30. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-9 precursor (ppy-mir-9-1)
  31. Procavia capensis (cape rock hyrax) microRNA 9-1 (ENSPCAG00000018990.1)
  32. Prolemur simus microRNA 9-1 (ENSPSMG00000010833.1)
  33. Pteropus vampyrus (large flying fox) microRNA 9-1 (ENSPVAG00000024864.1)
  34. Rattus norvegicus (Norway rat) microRNA rno-mir-9a precursor (rno-mir-9a-1)
  35. Rhinopithecus bieti microRNA 9-1 (ENSRBIG00000012671.1)
  36. Rhinopithecus roxellana microRNA 9-1 (ENSRROG00000017292.1)
  37. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 9-1 (ENSSBOG00000016120.1)
  38. Suricata suricatta microRNA 9-1 (ENSSSUG00005000134.1)
  39. Sus scrofa (pig) microRNA ssc-mir-9 precursor (ssc-mir-9-1)
  40. Tursiops truncatus (bottlenosed dolphin) microRNA 9-1 (ENSTTRG00000022795.1)
 Publications