Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-9 precursor (mmu-mir-9-1) URS000075C54E_10090

Automated summary: This pre miRNA sequence is 89 nucleotides long and is found in Mus musculus. Annotated by 6 databases (Ensembl/GENCODE, RefSeq, Ensembl, ENA, MGI, miRBase). Described in 39 papers. Matches 1 Rfam family (mir-9, RF00237). Mus musculus (house mouse) microRNA mmu-mir-9 precursor (mmu-mir-9-1) sequence is a product of mir-9-1 precursor, mmu-mir-9-1 precursor, mir-9-1 precurso, mir-9-1, Mir9-1 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 9-1 (MIR9-1)
    2. Capra hircus (Goat) microRNA 9-1
    3. Cercocebus atys (Sooty mangabey) microRNA 9-1 (MIR9-1)
    4. Chinchilla lanigera (Long-tailed chinchilla) microRNA 9-1 (MIR9-1)
    5. Colobus angolensis palliatus microRNA 9-1
    6. Cricetulus griseus (Chinese hamster) miRNA
    7. Dipodomys ordii microRNA 9-1
    8. Echinops telfairi miRNA
    9. Erinaceus europaeus (western European hedgehog) microRNA 9-1
    10. Fukomys damarensis (Damara mole rat) miRNA
    11. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 9-1
    12. Heterocephalus glaber microRNA 9-1 (MIR9-1)
    13. Homo sapiens microRNA hsa-mir-9 precursor (hsa-mir-9-1)
    14. Ictidomys tridecemlineatus microRNA 9-1 (MIR9-1)
    15. Jaculus jaculus microRNA 9-1 (Mir9-1)
    16. Loxodonta africana microRNA 9-1
    17. Macaca fascicularis (Crab-eating macaque) miRNA
    18. Macaca mulatta microRNA mml-mir-9 precursor (mml-mir-9-1)
    19. Mandrillus leucophaeus (Drill) microRNA 9-1 (MIR9-1)
    20. Mesocricetus auratus (Golden Hamster) microRNA 9-1 (Mir9-1)
    21. Microcebus murinus miRNA
    22. Microtus ochrogaster microRNA 9-1
    23. Mus caroli microRNA 9-1
    24. Mus pahari microRNA 9-1
    25. Mus spretus microRNA 9-1
    26. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    27. Octodon degus (Degu) microRNA 9-1 (MIR9-1)
    28. Pan paniscus (bonobo) miRNA
    29. Pan troglodytes (chimpanzee) ptr-mir-9-1
    30. Papio anubis (Olive baboon) miRNA
    31. Pongo abelii microRNA 9-1
    32. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-9 precursor (ppy-mir-9-1)
    33. Procavia capensis (cape rock hyrax) microRNA 9-1 (MIR9-1)
    34. Prolemur simus microRNA 9-1 (MIR9-1)
    35. Pteropus vampyrus microRNA 9-1 (MIR9-1)
    36. Rattus norvegicus microRNA rno-mir-9a precursor (rno-mir-9a-1)
    37. Rhinopithecus bieti microRNA 9-1 (MIR9-1)
    38. Rhinopithecus roxellana microRNA 9-1 (MIR9-1)
    39. Saimiri boliviensis boliviensis microRNA 9-1 (MIR9-1)
    40. Suricata suricatta (meerkat) microRNA 9-1
    41. Sus scrofa (pig) microRNA ssc-mir-9 precursor (ssc-mir-9-1)
    42. Tursiops truncatus (bottlenosed dolphin) microRNA 9-1 (MIR9-1)