Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-495 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-495 precursor URS000075C517_9606

  • 82 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 18 species

Automated summary: This pre miRNA sequence is 82 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl/GENCODE, RefSeq, Ensembl, MalaCards, ENA, GeneCards, HGNC, miRBase). Described in 43 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Homo sapiens (human) microRNA hsa-mir-495 precursor sequence is a product of hsa-mir-495 precursor, MIR495, mir-495 precurso, mir-495, mir-495 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGUACCUGAAAAGAAGUUGCCCAUGUUAUUUUCGCUUUAUAUGUGACGAAACAAACAUGGUGCACUUCUUUUUCGGUAUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Callithrix jacchus microRNA cja-mir-495 precursor
    2. Cercocebus atys (Sooty mangabey) miRNA
    3. Chlorocebus sabaeus (African green monkey) miRNA
    4. Colobus angolensis palliatus microRNA 495
    5. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 495
    6. Macaca fascicularis (Crab-eating macaque) miRNA
    7. Macaca mulatta microRNA mml-mir-495 precursor
    8. Macaca nemestrina miRNA
    9. Mandrillus leucophaeus (Drill) miRNA
    10. Microcebus murinus miRNA
    11. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    12. Otolemur garnettii (small-eared galago) miRNA
    13. Pan troglodytes (chimpanzee) ptr-mir-495
    14. Papio anubis (Olive baboon) miRNA
    15. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    16. Rhinopithecus bieti miRNA
    17. Rhinopithecus roxellana miRNA
    18. Saimiri boliviensis boliviensis miRNA
    19. Sciurus vulgaris miRNA
    2D structure New