Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-495 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-495 precursor URS000075C517_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR495: MIR495 is a microRNA that has been identified as possibly involved in UM tumorigenesis and/or metastasis [PMC2902045]. In a study exploring its role in the regulation of P-gp in MDR lung cancer cells, MIR495 was found to have a greatly elevated efficacy when combined with DOX in CCM/SLI/R-D, resulting in negative volume growth [PMC6841775]. In the RTT-mouse model, MIR495 was found to be significantly overexpressed and described to repress Bdnf [PMC8595945]. The binding ability of SLI to MIR495 was studied using a gel retardation assay, with naked MIR495 serving as a control [PMC6841775]. Additionally, the coating of CCM onto SLI/R-D followed a similar protocol as the binding of MIR495 [PMC6841775]. The EMT- and cancer stemness-promoting activities of intracellular GRP78 may be downregulated by certain endogenous protein factors such as DAL-1 [PMC7226806]. Overall, while limited studies are available on the role of miRNAs, including MIR495, their potential involvement in UM tumorigenesis and metastasis is being investigated [PMC2902045].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUACCUGAAAAGAAGUUGCCCAUGUUAUUUUCGCUUUAUAUGUGACGAAACAAACAUGGUGCACUUCUUUUUCGGUAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

2D structure Publications