Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 160 (LINC00160) URS000075C4D7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00160: LINC00160 is a long non-coding RNA (lncRNA) that has been implicated in the progression of glioma and renal cell carcinoma (RCC) [PMC7202521]. In a study, shRNAs against LINC00160 were used to downregulate its expression in glioma cells, resulting in increased sensitivity to sunitinib, a targeted therapy for glioma [PMC7521490]. This suggests that LINC00160 may play a role in the resistance to sunitinib treatment in glioma [PMC7521490]. Additionally, dysregulation of LINC00160 has been observed in RCC, indicating its potential involvement in RCC progression [PMC7202521]. These findings highlight the importance of further investigating the role of LINC00160 in both glioma and RCC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAUGAGGAAGCUCUCUGUGUACUGAUGGGGACAGAAGUUCCAGGACAUUUUGUAAGGUGGCUGAAAAACAAGACAGAUGCUUCCAGAAUCAAUCACCGAAUGGUGGAUCUACAGCCAACCACCCAUUCUCUUCAGUCACUGAGAUGAUAUGAUGCUGCUGGUCCAAGGACUACAUUUCGAGAACCCCAACCACGCAUGGAUUGUUGUCAACUAUGAAUCACAAGAUUUCCAGGGUUUUGUCUGCUGCCUUCCCUGCAAGCCCUGCCAUCCACUGAGACCCAACCUCAGCCAUUCUUGGCACAUCAGCCCAUGAGAAGUCUGCCACUCUUUCUUCCUAAGCAAAGCAGCAUCCUUCAGGGCCUGGAGCUCCUGGACACAAAAGCCAUUUUUGGGAGAAAAAUGUGGAUAAAGUCACUCCUGGGCCACCUGUCUGUGAGGCUGUAUGGAAGCUGCCUACUGGUUUGAGGAGAGGCUGCUGGGUUCUUUCCUUUACUAAGGAUUUGCUUAAGUCAGCCCUCCAGGAUCCAAAAAAGAGCCAGAAAAAAGCCAGCAAAACAGCUGAGGCACAGACUAGAUGGUAGUCCAAGGACCAAGACCUGGCCAGCCAGAGGGACCAGGUGUCCAGACCCCGGACUGUUUUCAAUACAGUUAUACAAUGAAAUCAAAUAAAUGGAUGUAUUGAUUGCUUGGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications