Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monopterus albus (swamp eel) Mal-Mir-26-P2b_5p (mature (guide)) URS000075C49C_43700

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUCCAGGAUAGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Danio rerio dre-miR-26b
  2. Eptatretus burgeri (inshore hagfish) Ebu-Mir-26-P7_5p (mature (guide))
  3. Gadus morhua gmo-miR-26b-5p
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-26b
  5. Ictalurus punctatus (channel catfish) ipu-miR-26b
  6. Maylandia zebra (zebra mbuna) mze-miR-26b
  7. Mus musculus Mus_musculus piRNA piR-mmu-49632556
  8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-26b
  9. Oreochromis niloticus (Nile tilapia) oni-miR-26b
  10. Otolemur garnettii (small-eared galago) oga-miR-26b
  11. Petromyzon marinus pma-miR-26b-5p
  12. Pundamilia nyererei pny-miR-26b
  13. Salmo salar ssa-miR-26b-5p
  14. Tetraodon nigroviridis Tni-Mir-26-P2b_5p (mature (guide))
  15. Tor tambroides miR-26b