Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Neolamprologus brichardi nbr-miR-26b URS000075C49C_32507

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Neolamprologus brichardi. Annotated by 1 database (miRBase). Found in the Neolamprologus brichardi reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCAAGUAAUCCAGGAUAGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 69 other species

    1. Danio rerio (zebrafish) dre-miR-26b
    2. Eptatretus burgeri Ebu-Mir-26-P7_5p (mature (guide))
    3. Gadus morhua (Atlantic cod) gmo-miR-26b-5p
    4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-26b
    5. Ictalurus punctatus (channel catfish) ipu-miR-26b
    6. Maylandia zebra mze-miR-26b
    7. Monopterus albus Mal-Mir-26-P2b_5p (mature (guide))
    8. Mus musculus Mus_musculus piRNA piR-mmu-49632556
    9. Oreochromis niloticus (Nile tilapia) oni-miR-26b
    10. Otolemur garnettii oga-miR-26b
    11. Petromyzon marinus pma-miR-26b-5p
    12. Pundamilia nyererei pny-miR-26b
    13. Salmo salar (Atlantic salmon) ssa-miR-26b-5p
    14. Tetraodon nigroviridis Tni-Mir-26-P2b_5p (mature (guide))
    15. Tor tambroides miR-26b