Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3654 precursor URS000075C471_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3654: Hsa-mir-3654 is a downregulated microRNA that has been identified in various studies [PMC8034913] [PMC6486473] [PMC4121995] [PMC8799182] [PMC9851309]. In a study on SW480/STAT3-siRNA cells, hsa-mir-3654 was one of the miRNAs that showed elevated expression levels compared to control cells [PMC4121995]. Another study found a statistically significant correlation between hsa-mir-3654 and patients' overall survival (OS) in cancer patients [PMC8799182]. Hsa-mir-3654 was also identified as one of the important cores of the ceRNET network in cancer cells [PMC8799182]. In addition, it was found to be expressed only in the Combo-Seq group and not in the small RNA group [PMC9851309]. Target prediction analysis revealed potential target genes for hsa-mir-3654, although no associated diseases were predicted for this microRNA [PMC6995532]. Furthermore, hsa-mir-3654 showed higher expression levels in LNCaP cells compared to normal and androgen-insensitive prostate cancer cell lines (PNT1A, PC-3) [PMC6780218]. Overall, hsa-mir-3654 is a downregulated microRNA that has been implicated in various biological processes and diseases [PMC8034913].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAUGAGCUGCAAUCUCAUCACUGGAAUGUUCCAGCGACUGGACAAGCUGAGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications