Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-1570

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-1570 URS000075C466_7227

22 nucleotides
1 database (PirBase)
Found in 8 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGGAAGACUAGUGAUUUUGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Ciona intestinalis (vase tunicate) cin-miR-7-5p
Gallus gallus gga-miR-7
Heliconius melpomene (postman butterfly) hme-miR-7
Monodelphis domestica mdo-miR-7
Mus musculus Mus_musculus piRNA piR-mmu-8283348
Oikopleura dioica odi-miR-7
Ptychodera flava Pfl-Mir-7_5p (mature (guide))
Xenopus tropicalis xtr-miR-7