v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan paniscus (bonobo) microRNA 450b (ENSPPAG00000008496.1) secondary structure diagram

Pan paniscus (bonobo) microRNA 450b (ENSPPAG00000008496.1) URS000075C453_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGAAUUAUUUUUGCAAUAUGUUCCUGAAUAUGUAAUAUAAGUGUAUUGGGAUCAUUUUGCAUCCAUAGUUUUGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Gorilla gorilla gorilla microRNA 450b (ENSGGOG00000029187.2)
  2. Homo sapiens microRNA hsa-mir-450b precursor
  3. Pan troglodytes ptr-mir-450b (ENSPTRG00000033645.2)
  4. Pongo abelii miRNA
  5. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-450b precursor
 2D structure Publications