Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2082 (LINC02082) URS000075C391_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02082: LINC02082 is a long non-coding RNA (lncRNA) that has been found to have altered expression levels in malignant thyroid nodules compared to normal thyroid tissues and benign nodules [PMC9483125]. The diagnostic potential of LINC02082, along with other lncRNAs such as LRRC52-AS1 and UNC5B-AS1, was assessed using receiver operating characteristic (ROC) curves in a thyroid cancer dataset [PMC9483125]. The combination of LRRC52-AS1, LINC02082, and UNC5B-AS1 showed promising results for the diagnosis of papillary thyroid carcinoma (PTC) using fine needle aspiration (FNA) samples [PMC9483125]. The expression levels of LRRC52-AS1, LINC02082, UNC5B-AS1, MPPED2-AS1, LNCNEF, and LOC100129129 could potentially differentiate between benign and malignant tumors in thyroid nodules [PMC9483125]. In a study involving 51 patients who underwent FNA on thyroid nodules, LRRC52-AS1 and LINC02082 were among the top upregulated candidates for PTC diagnosis [PMC9483125]. TaqMan Assay Mixes were used to analyze the expression levels of LRRC52-AS1, LINC02082, UNC5B-AS1 in FNA samples [PMC9483125]. The expression levels of LRRC52-AS1, LINC02082, and UNC5B-AS1 were significantly increased in malignant nodules compared to benign nodules and normal tissues [PMC9483125]. These lncRNAs could potentially differentiate between different categories of PTC based on their expression levels [PMC9483125]. Interestingly, the expression levels of LRRC52-AS1,LINC02082,and UNC5B-AS1 were not elevated in non-invasive encapsulated follicular thyroid neoplasm with papillary-like nuclear feature (NIFTP) [PMC9483125]. Previous studies have also shown elevated expression of LINC02082 in PTC tissues, suggesting its involvement in thyroid carcinogenesis [PMC9483125].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCAUCAUGGCUCACUGCAACCUCCGCCUCCCGGGAGAAUUGCUUGAACCCUGGAGGCGGAGGUUGCCGUGAGCUAACAUUGCGCCCCUACACUCCAGCCUGCCAACAGAGCAAGACUCCGUCUCAAAAAUAAAAAAAGGAUCUACUUUUGAGAAUACUGUCAUUGGUUGAUAAAAUACAGCAGAAACUUGUGAAGAAGCUAUUUUCCAUAUUCACCUGGCAUGUUUGGAGAUGAUUGCCAUCAACUUUGUGACUGUGAAGGAGAAACCUUCUGCCACCCAAAAACUGAAAAAUGCCUCUGCCCCCGUGGGAGAACUGGAGCCAGAUGUGAUGCUGGUUAGUCUCCUGUAUUGGGCGUUCAGCAUGGAUGUUGCCUUUUUCUGACCUCAAGACAACUAUCCAACUUUCCCUGUGUCCUUCACGAUGCAACCACUAAAGCUCUACUGAAGUCUCUAAUUCUGAGAAGGCACCUUAAAAAUUUGAAUCUAAUAACUUGCUUGGAUCAUAUGGCUCCUAAGUGGAGCAGAACUCAGGUUUGCCUCAUUCCAGAGGCCACGUUCUUGACUACAGCAUGCAUGCAAUUAUAAAACACUACCAUCGAGGAUGAAAAUCUAUACCCGUAAAUUUUGGAAAGUAAUAAAAUUUUGAUGAAUCCAAGUCAGAAUGAGUUCAUACUCCAGUUGCUAAUCAAGACACACACAGGUAGUCACAUUUUCAACCACCUUUAUUUUUGAUGCAUAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications