Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1247 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1247 precursor URS000075C329_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1247: MIR1247 is a microRNA that has been found to be dense in primary gastric cancer tissue but not in normal gastric cancer tissue [PMC9476644]. It has been shown that MIR1247, along with mir941, is silenced by DNA methylation in multiple gastric cancer cell lines [PMC9476644]. These microRNAs are regulated by gastric cancer DNA methylation transcription and have the ability to inhibit gastric cancer by inhibiting oncogenes [PMC9476644]. In a study comparing tumor tissue to adjacent nontumor tissue, the expression of MIR1247 was not increased in the tumor tissue [PMC7590111]. Inhibitors of MIR1247 have been shown to decrease cell viability across all cell lines [PMC7590111]. PCNXL3 is a gene that has been found to have a high correlation with colon adenocarcinoma and is one of the genes associated with hyper-methylated DMRs along with MIR1247 [PMC5986643]. The regulation of MIR941 and MIR1247 has been associated with gastric cancer cell growth and migration [PMC7541134]. In diabetes, expression changes of MIR1247 were not significantly returned to normal levels by treatment [PMC5114726]. It has been observed that MIR1247 may have different targets in various types of malignancies [PMC5966945]. Stable expression of MIR1247 was achieved through puromycin selection in infected cells, and its methylation levels were decreased by DAC exposure leading to increased expression [PMC6251029].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGCUUGCCUCGCCCAGCGCAGCCCCGGCCGCUGGGCGCACCCGUCCCGUUCGUCCCCGGACGUUGCUCUCUACCCCGGGAACGUCGAGACUGGAGCGCCCGAACUGAGCCACCUUCGCGGACCCCGAGAGCGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications