Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1288 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1288 precursor URS000075C2CE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1288: Hsa-mir-1288 is an upregulated microRNA (miRNA) that has been found to be differentially expressed in various conditions, including ectopic pregnancy (EP) and colorectal cancer [PMC5959728] [PMC7183093] [PMC5952075] [PMC5352919] [PMC5223123]. In EP, hsa-mir-1288 is upregulated compared to normal pregnancies, along with hsa-mir-451 and hsa-mir-223, while hsa-mir-196b, hsa-mir-30a, hsa-mir-873, and hsa-mir-337-3p are downregulated [PMC5959728] [PMC7183093]. Similarly, in colorectal cancer, hsa-mir-1288 is also upregulated and associated with disease progression [PMC5223123]. In addition to EP and colorectal cancer, hsa-mir-1288 has been found to be differentially expressed in other conditions as well. For example, it is upregulated in L02/HBx cells and associated with hepatocellular carcinoma progression [PMC5352919]. Furthermore, it has been identified as one of the differentially expressed miRNAs in ovarian tissues compared to other tissues such as liver and testis [PMC5223123]. Overall, the dysregulation of hsa-mir-1288 suggests its potential role as a biomarker or therapeutic target in various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGGGUGUUGAUCAGCAGAUCAGGACUGUAACUCACCAUAGUGGUGGACUGCCCUGAUCUGGAGACCACUGCCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications