Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-146b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-146b precursor URS000075C2A0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-146b: Additionally, miRNA hsa-mir-146b is highly expressed in PB NK cells, and its target TRAF6 has been reported to down-regulate NF-kB activity, suppress cell proliferation, and enhance chemosensitivity [PMC3640206]. The expression, log2 fold change, and adjusted p-value of hsa-mir-146b, hsa-miR-375, hsa-miR-31, hsa-miR-7-2, and hsa-miR-204 were then extracted from the overall results [PMC4918724].

MIR146B: MIR146B is a gene that can be targeted using the "PAM-out" strategy, where the PAM sequences are oriented towards the 3' region of the target DNA sequence [PMC8348963]. In a study, it was found that the expression of Th17-related microRNA (miR-155) and inflammasome-related molecules (AIM-2, Mincle, and NLRP3) was increased in response to an Aa challenge in the aorta [PMC4665422].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGGCACUGAGAACUGAAUUCCAUAGGCUGUGAGCUCUAGCAAUGCCCUGUGGACUCAGUUCUGGUGCCCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications