Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-653-3p URS000075C1A7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-653: Hsa-mir-653 is a microRNA that has been found to have low concentrations and is difficult to analyze [PMC3942699]. However, it has been identified as a potential target in several studies related to Alzheimer's disease (AD) [PMC9312389]. In addition, hsa-mir-653 has been shown to have a higher degree of interaction in a network analysis [PMC7510080]. It is speculated that hsa-mir-653 may play important roles in the biological behavior of EC (esophageal cancer) through multiple pathways [PMC7510080]. There are limited reports on the role of hsa-mir-653 in the malignant biological behavior of tumors [PMC7510080]. Hsa-mir-653 has also been identified as one of the miRNAs involved in child obesity traits [PMC9092671]. It has one functional binding site with hsa_circ_0003258 [PMC8599237]. Furthermore, hsa-mir-653 has potential target genes identified from various databases and is associated with poor prognosis in stomach adenocarcinoma (STAD) and lung cancer [PMC7423976] [PMC6856753] [PMC9322918]. In pancreatic ductal adenocarcinoma (PDAC), hsa-mir-653 expression levels were found to be different between tumor tissues and adjacent normal controls, with upregulation observed in PDAC tissues [PMC5649611].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACUGGAGUUUGUUUCAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Canis lupus familiaris Cfa-Mir-653_3p (mature (co-guide))
  2. Cricetulus griseus (Chinese hamster) cgr-miR-653
  3. Macaca mulatta mml-miR-653-3p
  4. Oryctolagus cuniculus (rabbit) ocu-miR-653-3p
Publications