v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-148b precursor URS000075C16C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR148B: MIR148B is a microRNA that is downregulated in breast cancer cases compared to controls [PMC9967215]. In a study, the ratio of MIR148B concentrations was found to be downregulated in breast cancer cases compared to controls [PMC9967215]. Additionally, MIR148B was found to be able to downregulate ACVR1/Alk-2 expression [PMC3515447]. The study also found that MIR21, MIR155, MIR10b, MIR373, MIR652, MIR425, and MIR29a showed coherent direction of ratio in breast cancer cases versus controls [PMC9967215]. However, the effect of mir26a on ACVR1/Alk-2 expression was unexpectedly positive [PMC3515447]. These findings suggest that the dysregulation of microRNAs such as MIR148B may play a role in breast cancer development and progression. Further research is needed to fully understand the mechanisms and potential therapeutic implications of these microRNAs in breast cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAAGCACGAUUAGCAUUUGAGGUGAAGUUCUGUUAUACACUCAGGCUGUGGCUCUCUGAAAGUCAGUGCAUCACAGAACUUUGUCUCGAAAGCUUUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Cercocebus atys miRNA (ENSCATG00000017789.1)
  2. Chlorocebus sabaeus (African green monkey) microRNA 148b (ENSCSAG00000021982.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000016364.1)
  4. Gorilla gorilla gorilla ggo-mir-148b (ENSGGOG00000032048.2)
  5. Macaca mulatta microRNA mml-mir-148b precursor
  6. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000020404.1)
  7. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000013289.1)
  8. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 148b (ENSNLEG00000025569.2)
  9. Pan paniscus (bonobo) microRNA 148b (ENSPPAG00000003979.1)
  10. Pan troglodytes ptr-mir-148b (ENSPTRG00000027662.2)
  11. Pongo abelii miRNA
  12. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-148b precursor
  13. Rhinopithecus bieti miRNA (ENSRBIG00000022607.1)
  14. Rhinopithecus roxellana miRNA (ENSRROG00000001123.1)
  15. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000009183.1)
 Publications