Automated summary: This miRNA sequence is 97 nucleotides long and is found in Lonchura striata domestica. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-21, RF00658). Lonchura striata domestica (Bengalese finch) microRNA 21 (ENSLSDG00000008831.1) sequence is a product of ENSLSDG00000008831.1 gene. Found in the Lonchura striata domestica reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UGUACCAUCCUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGGAUCUCAUGGCAACAACAGUCGGUAGGCUGUCUGACAUUUUGGUAUCUCUCA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.