Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1913 URS000075C082_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1913: Hsa-mir-1913 is a microRNA that has been identified in various studies [PMC6029031]. It is expressed in infected cells compared to uninfected cells [PMC6029031]. It has been detected in experiments and found to be expressed in tumor tissues [PMC7398623, PMC9340001]. However, its role in prostate has not been studied yet [PMC8100013]. The genomic interval for hsa-mir-1913 is not present in mice, and the mature hsa-miR-769 is not conserved in mice, suggesting that these miRNAs do not have a potential cleavage role [PMC3333847]. Hsa-mir-1913 has been found to interact with other miRNAs and lncRNAs, such as hsa-miR-2355 and TP53TG1 [PMC9307901]. Mutations have been identified within the sequence target for hsa-mir-1913, which can affect its interactions with other molecules [PMC3766605]. In silico analyses have shown that these mutations introduce mismatches that abolish the interactions of hsa-mir-1913 with other miRNAs [PMC3766605]. The expression of hsa-mir-1913 has also been associated with poor overall survival in certain cancers such as CESC [PMC7333649]. However, further studies are needed to fully understand the functions and roles of hsa-mir-1913 [PMC8321750].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGCCCCCUCCGCUGCUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications