Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-327 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-327 precursor URS000075C06F_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-327: Mmu-mir-327 is a microRNA that is least homologous to bta-mir-2422, rat rno-mir-327, and mouse mmu-mir-327 [PMC6722470]. The primers used for amplification of miR-327 were mmu-mir-327: 5′-ACUUGAGGGGCAUGAGGAU-3′ and rno-miR-327: 5′-CCUUGAGGGGCAUGAGGGU-3′ [PMC5810199]. Custom miRCURY in vivo LNA inhibitor probes were used against mmu-mir-327, with a LNA inhibitor control serving as a negative control [PMC5727036]. Transfection experiments were conducted using ON-TARGETplus SMARTpool siRNAs against Fgfr2 and Fgf10, miRIDIAN mmu-mir-327 mimic, mmu-mir-327 miRCURY LNA inhibitor, and their respective negative controls at a final concentration of 25 nM [PMC5727036]. An adenovirus overexpressing mmu-mir-327 was injected into scWAT and visWAT [PMC5727036]. Among the significantly differentially expressed miRNAs, mmu-miR1223p, mmu-miR6238, mmu-miR669a3p, mmu-miR691, mmu-miR2233p, mmumir327 ,mmummiR207 ,andmmummiR466f3p were upregulated whilemmummiR30f ,mmummiR344b5p ,mmummiR28b ,mmummi R2963p ,mmumm i R70623 p,and m mumm i R30905 p were downregulated [PMC5819906].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCCUUAUAACUUGAGGGGCAUGAGGAUAGUCAGUAGUCCAACAUCCCUCUUGAUGGCACAUUGCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications