Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) microRNA ame-mir-3747a precursor URS000075C03E_7460

Automated summary: This pre miRNA sequence is 67 nucleotides long and is found in Apis mellifera. Annotated by 4 databases (miRBase, RefSeq, ENA, Rfam). Matches 1 Rfam family (mir-3747, RF03640). Apis mellifera (honey bee) microRNA ame-mir-3747a precursor sequence is a product of 3747, Mir3747a, 3747 microRNA precursor famil, ame-mir-3747a precursor, 3747a, mir-3747a precurso, mir-3747a, 3747 microRNA precursor family, mir-3747 microRNA precursor family, mir-3747a precursor genes. Found in the honey bee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGCCUGCGAGGCUUUUUUUCAGCGAUGAAUAAAAAUAUUGUUCAUCGUUGGAAAAAAGUCUUGGAGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Publications New