Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-302f precursor URS000075C007_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-302f: Hsa-mir-302f is a transgenic human exomiR that is released from adipocytes and can affect gene expression in the liver [PMC9464960]. It has been observed that hsa-mir-302f can repress the luminescent signal from hepatocytes in mice that express a 3′UTR reporter specific for hsa-mir-302f [PMC9464960]. The expression of hsa-mir-302f was induced in the brown adipose tissue (BAT) of mice to investigate if adipose-derived miRNAs can travel to the liver [PMC5539684]. To validate this, hsa-mir-302f was expressed in the BAT of one mouse and a reporter was expressed in the liver of another mouse, and exosomes containing hsa-mir-302f were injected into the mouse with the reporter [PMC5539684]. The use of human-specific miRNA (hsa-mir-302f) ensured that it did not have a mouse homolog [PMC5539684]. The activity of the reporter in the liver indicated if hsa-miR from BAT had traveled to the liver, as mice liver does not naturally have human hsa-mir-302f [PMC5539684]. The pre-miRNA secondary structure of miRNA hsa-mir-302f has been determined using an algorithm developed by Mathews et al. [PMC6397858]. Hsa-mir-302f is associated with seven diseases, including head and neck neoplasms, breast neoplasms, and gastric neoplasms [PMC7820843]. Adenoviral delivery of hsa-miR-302f to BAT resulted in suppression of a miR-302f 3′ UTR reporter in liver [PMC5572399].

MIR302F: MIR302F is a microRNA that has been associated with crystal-induced inflammation, which is the final stage of gout development [PMC9333104]. It has been found to be down-regulated in gout patients [PMC8553949]. In a genome-wide association study (GWAS) comparing gout patients to individuals with asymptomatic hyperuricemia (AHUA), the MIR302F locus was identified as one of the risk loci for gout [PMC6788923]. Additionally, an intergenic SNP near MIR302F, rs9952962, was found to be associated with gout in a meta-analysis of three stages [PMC6788923]. Furthermore, MIR302F is located on chromosome 18q12.1, which has been associated with Alzheimer's disease in previous GWAS studies [PMC6330399]. References: - [PMC9333104]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9333104/ - [PMC8553949]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8553949/ - [PMC6788923]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6788923/ - [PMC6330399]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6330399/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGUGUAAACCUGGCAAUUUUCACUUAAUUGCUUCCAUGUUUAUAAAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications