Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4261 precursor URS000075BFB5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4261: Hsa-mir-4261 is a microRNA that can target the REL gene, and it is one of the 153 miRNAs that can target REL [PMC7854084]. Hsa-mir-4261, along with hsa-miR-6836-3p, has been identified as a potential anti-cancer therapeutic due to its relevance to multidrug resistance caused by ABC family activity or MGMT proteins [PMC7404280]. Additionally, hsa-mir-4261 has been selected as a potential anti-cancer therapeutic for regulating the DNA repair protein MGMT [PMC7005303]. Hsa-mir-4261 is one of the miRNAs that include hsa-miR-370, hsa-miR-491-5p, hsa-miR-6836-3p, and others that have been identified as potential therapeutics for regulating MGMT mRNA [PMC7005303]. In a study investigating miRNAs with high Target scores, hsa-mir-4261 was further examined [PMC7005303]. Using specific filtering criteria for ABCB1 and MGMT mRNA regulation, three miRNAs were identified as potential therapeutics: hsa-miR-370, hsa-mir-4261, and hsa-miR6836 [PMC7005303].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGGAAGUGGGUUCCUCCCAGUUCCUGAGACAGGAAACAGGGACCCAGGAGACCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 4261 (ENSGGOG00000041806.1)
Publications