Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-374b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-374b precursor URS000075BF8B_9606

  • 72 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 21 species

Automated summary: This pre miRNA sequence is 72 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, Ensembl, GeneCards, miRBase, Ensembl/GENCODE, ENA, MalaCards, HGNC). Described in 32 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-374, RF00840). Homo sapiens (human) microRNA hsa-mir-374b precursor sequence is a product of MIR374B, mir-374b precursor, hsa-mir-374b precursor, mir-374b precurso, mir-374b genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUCGGAUGGAUAUAAUACAACCUGCUAAGUGUCCUAGCACUUAGCAGGUUGUAUUAUCAUUGUCCGUGUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Aotus nancymaae miRNA
    2. Castor canadensis miRNA
    3. Cercocebus atys (Sooty mangabey) miRNA
    4. Chlorocebus sabaeus (African green monkey) miRNA
    5. Colobus angolensis palliatus microRNA 374b
    6. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 374b
    7. Macaca fascicularis miRNA
    8. Macaca mulatta microRNA mml-mir-374b precursor
    9. Macaca nemestrina miRNA
    10. Mandrillus leucophaeus (Drill) miRNA
    11. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    12. Pan paniscus (bonobo) miRNA
    13. Pan troglodytes (chimpanzee) ptr-mir-374b
    14. Papio anubis (Olive baboon) miRNA
    15. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    16. Pongo abelii miRNA
    17. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 374b
    18. Rhinopithecus bieti miRNA
    19. Rhinopithecus roxellana miRNA
    20. Saimiri boliviensis boliviensis miRNA
    21. Theropithecus gelada microRNA 374b
    2D structure New