Pongo pygmaeus (Bornean orangutan) ppy-miR-454

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-454 URS000075BF7E_9600

22 nucleotides
1 database (miRBase)
Found in 4 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAGUGCAAUAUUGCUUAUAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Canis lupus familiaris cfa-miR-454
Danio rerio dre-miR-454b
Haplochromis burtoni (Burton's mouthbrooder) abu-miR-454b
Tor tambroides miR-454b

Publications