Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000022536.1) secondary structure diagram

Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000022536.1) URS000075BF74_1328070

Automated summary: This pre miRNA sequence is 89 nucleotides long and is found in Prolemur simus. Annotated by 1 database (Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-181, RF00076). Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000022536.1) sequence is a product of ENSPSMG00000022536.1 gene. Found in the greater bamboo lemur reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAGUCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAAACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 85 other species

    2D structure