Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) cancer susceptibility 21 (CASC21) URS000075BF52_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CASC21: CASC21 is a long non-coding RNA (lncRNA) that has been found to play a role in colorectal cancer (CRC) progression. It promotes CRC cell proliferation, migration, and invasion while inhibiting cell apoptosis by regulating the miR-7-5p/YAP1 axis [PMC10052384]. Knockdown of CASC21 has been shown to increase the expression of GSK3β [PMC7028851]. The specific siRNA sequences used for CASC21 knockdown are siRNA1#, 5′‐GGTTGTTGCTTCCTAGTCT ‐3′ and siRNA3#, 5′‐GCTGAGTTCTACTAGCAAA ‐3′ [PMC7028851]. On the other hand, overexpression of CASC21 in HCT-116 cells has been found to significantly increase tumor formation compared to the control group [PMC7343488]. To further investigate the clinical relevance of CASC21 in CRC, enrolled patients were divided into two groups based on their CASC21 expression levels [PMC7343488].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACACCGAAUAACUCGUUACAAAAAGAGCUAGGGUCCCAGACUGCGCCAAAGCUUCAGGAGACUGCUCCUCGUCUGUGCACAGAUGAGUGGCCAACUCUGGAGCCCAGGUUGUUGCUUCCUAGUCUGGUGGUGAAUCCUUCAUAGUCUGAGUCUCACUUGGUUGCUCAGACUGGAGUACAGUGGUACGAUCUCGACUCACUGAAACCUCUGCUUCCUGGCUUCAAGCAUUUCUCCUGCCUCAGCCUCCUGAGUAGCUGAGAUUACAGGCGCCCACCACCAAAAAAAAAAUAACCCAGCCUCAGAGGUGCUUAUUUAGCAAAUUCAACCUUAAACCUGAGUGCAUGGAAACUAUUGAUGCAGUGUCCAAGGUGGAGAAAGGUCAGAGUGGAUCCAGAGGAGCCAAGAGAAGACGUCCAGCAUGGUGACCUGGGCUCAAGUCAAGGUCCUUAUUUCUCUGCUGAACCAUCACAUUCCUUAUACAGAGUGGGACAGCAUUGGCUGAGUUCUACUAGCAAAUGCCGGAGAUGUGGUUCCUGUUGGCCUUUUAACUGAUGUGAUGAAAUAAAGUCUUCCAUAAUUUGACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications