Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-373 precursor URS000075BF4B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR373: MIR373 is a microRNA that has been predicted by computational algorithms to regulate several proteins involved in the actin cytoskeleton, including twinfilin-1 and-2, thymosin, and profilin-2 [PMC7408560]. In a study evaluating breast cancer biomarkers, MIR373 was selected as a candidate and its expression levels were assessed in breast cancer patients and healthy individuals [PMC8182592]. Another study found that MIR373 was involved in a subpopulation of chemo-resistant circulating tumor cells (CTCs) with extensive aberrations and marked metastatic ability [PMC8466266]. Additionally, MIR373 levels were found to be upregulated in the substantia nigra of patients with Parkinson's disease, suggesting its involvement in α-synuclein clearance defects [PMC6627933]. These findings highlight the potential role of MIR373 as a regulator of actin cytoskeleton proteins, a biomarker for breast cancer, chemo-resistant CTCs, and Parkinson's disease pathology.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGAUACUCAAAAUGGGGGCGCUUUCCUUUUUGUCUGUACUGGGAAGUGCUUCGAUUUUGGGGUGUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 373 (ENSGGOG00000030050.2)
Publications