Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-6352 URS000075BEF8_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-6352: Mmu-mir-6352 is one of the 54 miRNAs that have never been reported as ovarian-predominant miRNAs in any vertebrate species [PMC5223123]. The expression of mmu-mir-6352 in the ovary is particularly strict, along with hsa-miR-4785, dre-miR-729, and hsa-miR-4653 [PMC5223123]. In medaka, mmu-mir-6352 has two co-orthologs (ola-mir-6352-1 and ola-mir-6352-2), which may have resulted from the teleost genome duplication [PMC5223123]. In addition to mmu-mir-6352, hsa-miR-4785 and mmu-mir743a also have two coorthologs in medaka [PMC5223123]. However, ola-mir202, ola-mir487b, ola-mir4653, ola mir878 and ola mir1288 appear to have only one copy in the medaka genome [PMC5223123]. Mmu mir 6352 is one of the seven candidates that exhibited an ovarian-predominant expression profile consistent with microarray data [PMC5223123]. Among these candidates were also hsa miR 4785 dre miR 729 hsa miR 4653 rno miR 878 hsa miR487b and hsa mir1288. Except for dre mir729 these microRNAs were previously uncharacterized in fish [PMC5223123]. However, seven differentially expressed (DE) microRNAs including mmu mir8109 mmu mir76623p mmu mir6539 mmu mir5124b mmu mir6402 mmummi r142a 3p and mmu mir6352 were removed from further analysis due to not fulfilling the target gene prediction criterion [PMC6624655]. Lastly, the study provided the sequences of the primers for amplification of five off-target sites, including the intergenic regions of Lca5 and Sh3bgrl2, Gm1815 and Zfp353, Kif2b and Gm11498, Epha4 and mmu mir6352, as well as the intron of Dagla [PMC6708192].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGGAAAAGGACCCCAGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications