Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-432 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-432 precursor URS000075BECB_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-432: Mmu-mir-432 is a microRNA that was analyzed in a study using primer sequences [PMC8810136]. In the study, the expression of mmu-mir-432 was not significantly different between the blank and model groups [PMC8810136]. Previous studies have shown that mmu-mir-432, along with other microRNAs, is significantly inhibited in T2DM islets [PMC8810136]. Additionally, the expression of mmu-mir-432 was found to be decreased in depressive BALB/c mice and partially recovered with an ADAR1 inducer [PMC8449188]. The ADAR1 inducer also rescued abnormal levels of other molecules such as mmu-bdnf mRNA and mmu_circ_0000418 in the frontal cortex of mice [PMC8449188]. These findings suggest that mmu-mir-432 may play a role in T2DM and depressive-like behavior [PMC8810136][PMC8449188].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGUAGCUCUUGCAUUUCCUGGUGGGGGCCACUGGAUGGCUCCUCCACUUCUUGGAGUAGAUCAGUGGGCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications