Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-599 precursor URS000075BEB9_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-599: Mmu-mir-599 is a type of microRNA that was transfected into Hepa1-6 cells for gain and loss-of-function experiments [PMC8846938]. Transfection with mmu-mir-599 mimic reduced PXR 3'UTR-dependent luciferase activity [PMC8846938]. Mice treated with resveratrol showed reduced mmu-mir-599 expression and increased PXR expression [PMC8846938]. The online database miRDB was used to verify the sequence of mmu-mir-599 and predict PXR as a potential target gene [PMC8846938]. The full-length coding sequences of PXR were amplified and subcloned into a plasmid for further analysis [PMC8846938]. The study aimed to investigate the therapeutic role of resveratrol in NASH and its effects on mmu-mir-599, PXR, and related inflammatory genes [PMC8846938]. The binding site of mmu-mir-599 in the PXR mRNA sequence was confirmed through luciferase activity assay with site mutation [PMC8846938]. Mmu-mir-599 mimic suppressed the mRNA and protein expression levels of PXR, while the inhibitor had the opposite effect in Hepa1-6 cells [PMC8846938]. Resveratrol downregulated mmu-mir-599 expression but upregulated mRNA and protein expression levels of PXR in NASH model mice and Hepa1-6 cells [PMC8846938]. Mmu-mir-599 expression was increased in NASH model mice, suggesting its potential role in NASH development through inhibiting PXR expression at the transcriptional level [PMC8846938]. Resveratrol's anti-inflammatory effects may be mediated by mmu-mir-599, but further investigation is needed to understand the detailed mechanisms involved [PMC8846938].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUGUCCACAGUGUAUUUGAUAAGAUGACAUAGGAGAGGAACUUCUUUCACCUUUGUGUCAGUUUAUCAAACCCAUACCUGGAUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications