Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-574 precursor URS000075BE91_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR574: MIR574 is a microRNA that has been identified in various studies and is associated with different biological processes and diseases. It has been reported that MIR574, along with let-7b and miR21, can act as a self-ligand of TLR7 for plasmacytoid DCs activation in systemic lupus erythematosus (SLE) patients [PMC9762196]. MIR574 is located on human chromosome 4p14 and is generated through a multi-step process [PMC9855975]. It has also been found to be age-demethylated in MIR10A and age-methylated in MIR219-2, MIR183/MIR96, and MIRLET7A3/MIRLET7B [PMC4396570]. In studies on CNS tumors, including glioblastoma, MIR574 was found to be down-regulated along with other miRNAs (MIR149, MIR214, MIR595, and MIR765) [PMC8235499]. Additionally, it was observed that the down-regulation of these miRNAs could serve as diagnostic markers for CNS tumors [PMC8235499]. In other studies on different cancers such as gastric cancer, thyroid cancer, brain cancer, head and neck squamous cell carcinoma (HNSCC), and esophageal squamous cell carcinoma (ESCC), the dysregulation of MIR574 was also observed [PMC9775590] [PMC9098838]. These findings highlight the potential role of MIR574 in various diseases and its potential as a diagnostic or prognostic marker.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGACCUGCGUGGGUGCGGGCGUGUGAGUGUGUGUGUGUGAGUGUGUGUCGCUCCGGGUCCACGCUCAUGCACACACCCACACGCCCACACUCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications