v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cervus hanglu yarkandensis (Yarkand deer) miRNA (ENSCHYG00000010367.1) secondary structure diagram

Cervus hanglu yarkandensis (Yarkand deer) miRNA (ENSCHYG00000010367.1) URS000075BE1F_84702

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUCACCUGACCUACUGCUGAGCCAGCACUUCCCGAGCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Bison bison bison miRNA (ENSBBBG00000000974.1)
  2. Bos grunniens miRNA (ENSBGRG00000019656.1)
  3. Bos indicus x Bos taurus miRNA (ENSBIXG00000029897.1, ENSBIXG00005007488.1)
  4. Bos mutus (wild yak) miRNA (ENSBMUG00000023668.1)
  5. Bos taurus microRNA bta-mir-93 precursor
  6. Cervus elaphus hippelaphus ncRNA
  7. Moschus moschiferus (Siberian musk deer) miRNA (ENSMMSG00000013442.1)
 2D structure