Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos grunniens (domestic yak) miRNA (ENSBGRG00000019656.1) secondary structure diagram

Bos grunniens (domestic yak) miRNA (ENSBGRG00000019656.1) URS000075BE1F_30521

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUCACCUGACCUACUGCUGAGCCAGCACUUCCCGAGCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Bison bison bison miRNA (ENSBBBG00000000974.1)
  2. Bos indicus x Bos taurus miRNA (ENSBIXG00000029897.1, ENSBIXG00005007488.1)
  3. Bos mutus (wild yak) miRNA (ENSBMUG00000023668.1)
  4. Bos taurus microRNA bta-mir-93 precursor
  5. Cervus elaphus hippelaphus ncRNA
  6. Cervus hanglu yarkandensis miRNA (ENSCHYG00000010367.1)
  7. Moschus moschiferus miRNA (ENSMMSG00000013442.1)
2D structure