Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-138 precursor (hsa-mir-138-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-138 precursor (hsa-mir-138-1) URS000075BD79_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR138-1: MIR138-1 is a microRNA that has been studied in various contexts [PMC4468152]. It has been found that there is no overt SC differentiation deficit in MIR138-1 cKO nerves [PMC5830491]. Mendelian randomization analysis has identified DNA methylation levels of two CpGs in the transcription activator DLX2 and micro-RNA MIR138-1, which may have causal effects on iCHD [PMC8501606]. Additionally, two CpGs near DLX2 and MIR138-1 have been identified with putative causal effects on iCHD [PMC8501606]. MIR138-1 is one of the brain-enriched microRNA-coding lncRNAs, along with precursors for MIR4500, MIR2113, MIR137, MIR548N, and MIR9-3 [PMC4468152]. The miRBase database provides information on the genes for both MIR138-1 and its homologous gene, MIR138-2 [PMC7376782]. In a study comparing brain regions, it was found that the expression of several miRNAs including MIR656, MIR29B2CHG, and ENSSTOG00000034702 decreased significantly in LT and Ar compared to IBA [PMC7848201]. This also included a decrease in expression of miR101-1 and ENSSTOG00000034702 [PMC7848201]. The genomic context of several abundant microRNAs including let7b and mir26b was explored to determine if it influenced their accumulation [PMC4057207]. It was found that let7b and mir26b displayed clusters of adenylation for mMtr4KD [PMC4057207].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUGGCAUGGUGUGGUGGGGCAGCUGGUGUUGUGAAUCAGGCCGUUGCCAAUCAGAGAACGGCUACUUCACAACACCAGGGCCACACCACACUACAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications