Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1307 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1307 precursor URS000075BD54_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1307: MIR1307 is a microRNA that has been found to be differentially expressed in various studies and is associated with different conditions and diseases, including schizophrenia (SCZ) [PMC5804029]. In a study on SCZ, MIR1307 showed a clear trend toward association with the same direction of effect in the data from the dorsolateral prefrontal cortex (DLPFC) [PMC5804029]. The expression of MIR1307 was found to be approximately threefold higher in controls compared to SCZ patients [PMC5804029]. MIR1307 has also been implicated in other diseases, such as ovarian cancer and gastric cancer [PMC8472271] [PMC7922229]. In ovarian cancer, MIR1307 was found to inhibit apoptosis by down-regulating the expression of ING5 [PMC8472271]. Additionally, MIR1307 has been proposed as a potential biomarker for patients who may benefit from certain chemotherapy regimens, such as FOLFIRINOX [PMC9764499] [PMC8602334]. It has also been associated with drug resistance in breast cancer and pancreatic ductal adenocarcinoma (PDAC) cells exposed to chemotherapy [PMC8076833] [PMC8602334]. The role of MIR1307 in mediating chemoresistance has been studied extensively, and it has been shown to affect sensitivity to platinum-containing regimens and DNA damage repair pathways [PMC8602334]. Furthermore, MIR1307 has been identified as a potential therapeutic target for SARS-CoV-2 infection prevention [PMC7354481].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCAAGACCCAGCUGAGUCACUGUCACUGCCUACCAAUCUCGACCGGACCUCGACCGGCUCGUCUGUGUUGCCAAUCGACUCGGCGUGGCGUCGGUCGUGGUAGAUAGGCGGUCAUGCAUACGAAUUUUCAGCUCUUGUUCUGGUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

2D structure Publications