v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MCM3AP antisense RNA 1 (MCM3AP-AS1) URS000075BD4C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MCM3AP-AS1: MCM3AP-AS1 is a long noncoding RNA (lncRNA) that has been implicated in various diseases, including osteoarthritis (OA), chronic obstructive pulmonary disease (COPD), breast cancer, liver cancer, prostate cancer, pancreatic cancer, papillary thyroid cancer, clear cell renal cell carcinoma (ccRCC), gastric cancer, hepatocellular carcinoma (HCC), glioblastoma cancer, lung cancer, colorectal cancer (CRC), myocardial infarction (MI), squamous cell carcinoma of the skin (CSCC), and endometrial carcinoma (EC) [PMC8806229] [PMC7503009] [PMC8799146] [PMC9258118] [PMC7519818] [PMC8529123] [PMC8511435] [PMC7344272] [PMC8529123] [PMC8873123] [PMC8511435] [PMC8529123] [PMC6381672] [PMC8799054] [PMC9344752] [PMC9249515] [PMC8799146] [PMC5767169] [PMC7319531] [PMC7007402] [PMC7494958] [PMC7494958] [PMC8973343] [PMC8806479] [PMC7359251] [PMC9983800] [PMC9107717] [PMC6381672] [PMC7371474] [PMC9107717] [PMC7319531] [PMC8278665] [PMC9249515] [PMC8283830]. MCM3AP-AS1 has been shown to interact with various microRNAs and transcription factors to regulate cell proliferation, migration, invasion, apoptosis, and angiogenesis in different types of cancers and diseases [PMC8529123]. It has been found to be upregulated in several cancers and associated with poor prognosis and clinicopathological features such as tumor size, stage, and metastasis [PMC9249515]. Conversely, MCM3AP-AS1 downregulation has been observed in diabetic retinopathy [PMC9107717]. The functional roles of MCM3AP-AS1 are mediated through its interactions with different microRNAs such as miR-138-5p/FOXK1 axis in pancreatic cancer and miR-211/KLF5 pathway in glioblastoma [PMC8529123]. Additionally, MCM3AP-AS1 can act as a competing endogenous RNA for miRNAs such as miR-195-5p/E2F3 axis [PMC8806479]. The molecular mechanisms underlying the functions of MCM3AP-AS1 involve the regulation of various target genes/pathways, including FOXC1, PTEN, WNT5A, CDK4, KPNA4, AGGF1, and KLF5 [PMC8529123]. These findings suggest that MCM3AP-AS1 plays a crucial role in the pathogenesis and progression of different diseases and may serve as a potential therapeutic target or prognostic biomarker [PMC9249515].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCCCGGGAGCCCGGCCUCGUGCGCCGCGCUUUGAGCAGCAGACUGCUCGACAAACACUGCGCCAAGAGCUCCUCAGCAGAAGCUCCUCGCAUCAGAUCCUCUGUGCUGGGAAUCCUCCCCUCUUGAGCACACUCUGUGCUCCUCUUCCAGUUACGGUGCAUGUGAAGCAAUGGUAUGGGAAAAUUGUUUGCAGAAGGAUGAAAAGGCUUUAUUGCCAAACUCUUAAGGUAUUUUGUUAAUAAAAUCAUUUUCAUAAUGGAAAAGACUCAGAAAAUUCCCCUCGCAUGACAUAUAACAUCCAACAAGGGGCUGAACCAAGAAAAAAUACUGCAGCUGCUGCUAAUGGCAACACUGAGCAAGCACCUGGCCUGUGCCAGGCACUGUCCUGUGCAGUCUGUGUUUGCACUCAUUUUAUCCUCAAGAGCCAGAUGAGCAUCUCCACCAGACAGCACCUGCAGAGGCUUGGGCAGUUUAUUUUACCGUCUCUGAGUAAAAUAGGGAUAAUAAGUAACAGUACCCAUACACAGGUGGCAGAGACGCUAGGGAACUUGCCCAAGGUCACAGAGCUUCCAAGUGGAGGAGCAGGGACACAUAUGCUCACAAUGAUGGCACUAAGGCACAUGUUGCCUGGAUGGAGACCAGCCCACAGAUGAGAGUUCCAGGACAGAGGGAACAUGGAUGGAUCAAGUGAAGUGACAGAACAUUUGGAAAACUCUACCGAGAUAUAUACGGCCCCCCAGUAAAAUUAAAGAGAUAAAGAGAACUACAUUAAGUGAGACAAUAAGGCAACUCUAUUUCUUGCAGGAAAAAAAUAAUUGUGGUUAUAGAACACUACUGGUUCUGAGGUGAAUAGCAGUCACAGAGCCAUCAAAAUAUGACCCCACUCACUGAAGUAAUACAAAGUGCUAGUGUAGCUAUCCCGGGAAGACGUGGAAGGCCGAGCAAGGACCAUGGCACAAGAGGCCACGCUGUACCUAGUAUGGUAUGCAGUGGCCAAGAGGACCCCCCUGAUUCCACCUAGUGUUCAUGCCCACGUGUGAUCUCCUGCCCCGUGAGCUGGGCCUAGCCACUCACUUCUGACAGACAGAAGCCAACAAAAGCAACAGGAUGUCACUUCUAAGUUUAGGUUAUAAACACACUCAGACUUCCAUCUAGGCUCACCUCUUGCUCACUCUGAUGAAAGCCAGCUGCCAUGCUGUCAGCUGGGGAGAGGCCCAUGUGGCAGGAACUGAGGAAGUCUUUGGCCACAGCCUGCAAGGAAGUGAAUCCUGACACAAGCUCACUAGAGUGAGCUGGGAAGUAGAUACCCUUCAGUCAAGCUUUCAGAUGAGGCCACAAUCCUAGCCAACAUUUUCAUUUCCACCCAUGAGAAACCUUGAGCCAGAAGACCCAAGCUAAGCUACACCUGGAUUCCUGACCCACAGAUACCAUGAUAACAGACAUUAUUUUAAGCUGCUAUGUUAGGAGUAAUUAGUUAUUUAGGAAUAAGGUAACUAAUACAUUUAUAUUAAUGGGAAGUCAGCAGAGAACAUUUAAAUGGAUAAACUGAGAAAUGGCUGUGUAAGUGUGUGAUCUGGAAACAGGAGAAAAAUGCAGCCCUGAAGAAAGGAGUUAAGAGAGGAAGGAGGAGCUACUAUGUCUCAUUUUAAAUCACGUGGGUGGCAUUAUUUGACUUCUUUUUAAGUACACGGAAGUGUUACUUUCUUAAAUGAAAAUGAAGGUAACAGCAGCAGUAAACUAAUUUCCAGUAGAUGAAAUGUGACUUUGUAAUCCCAGGAAAAGGGAAGAAUUUGCACCAAGAAGUUACUGUUACCUCAGAAUGGCAAGAGCAUGGAUGGCUCUUAUCAUCAUCUUUAUACUUCUUUUACAUUUCCUCAUUUUUUAAAAGUUUUGUGUACAUAUUACAUUUAGGAAAUCCAAUAUAUAGUAUUAAAACAGAAAAAGUAAAGAAGCAGGCUGGGCUUGGUGCCCACUACUCAAUUUGACUGGCUUAAAAAAAUUUUUUAAACGACAUGUACGGACAGACAUAAUACUUGCUUCUGAGCCUCCCAGUCUUUCAAAACCACAUUAGGGAAUAAGCAGUAUUUGCAUGGUUCCAGUGAUAUCUGGGAGUAAGUGAAAGUAAUGAAAACACAGAAGUAAACACAAAGUAAUUAUAGUUCACCUUUAUACACACGUUAACAGAAAUCAUCUGAUCCCCUUUGCUGCUAAGUGAGUUGAAAAGCGAAAGCGUCUGAAUCCCACCAGCAUCGCUGGAUGUGUCAUCCACUGAGCCUUCAUCUCCCAUGAACUUGACUUUUAACCAAUUUGCUAGAAUUCUACAGAUUUAAAAAAAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications