Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-450a precursor (bta-mir-450a-1) secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-450a precursor (bta-mir-450a-1) URS000075BCFF_9913

Automated summary: This pre miRNA sequence is 82 nucleotides long and is found in Bos taurus. Annotated by 4 databases (ENA, RefSeq, miRBase, Ensembl). Described in 5 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-450, RF00708). Bos taurus (cattle) microRNA bta-mir-450a precursor (bta-mir-450a-1) sequence is a product of MIR450A-1, mir-450a-1, mir-450a-1 precurso, 450a-1, bta-mir-450a-1 precursor, bta-mir-450a-1, mir-450a-1 precursor genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUAUUUUUGCGAUGUGUUCCUAAUAUGCAGUAUAAAUAUAUUGGGAGCAUUUUGCAUGCAUGGUUUUGUAUCAAUAUACAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Balaenoptera musculus miRNA
    2. Bison bison bison (American bison) microRNA 450a-1
    3. Bos grunniens (domestic yak) microRNA 450a-1
    4. Bos indicus x Bos taurus microRNA 450a-1
    5. Bos mutus microRNA 450a-1
    6. Camelus dromedarius (Arabian camel) microRNA 450a-1
    7. Capra hircus (goat) miRNA
    8. Cervus hanglu yarkandensis (Yarkand deer) miRNA
    9. Delphinapterus leucas microRNA 450a-1
    10. Monodon monoceros (narwhal) miRNA
    11. Moschus moschiferus microRNA 450a-1
    12. Panthera leo (lion) microRNA 450a-1
    13. Physeter catodon (sperm whale) microRNA 450a-1
    2D structure New